circad | circRNAs associated with diseases

F-circEA
Gene	EML4-ALK	Organism	Human
Genome Locus	Exon4(EML4)-Exon22(ALK)	Build	hg19
Disease	Non-Small cell Lung Cancer tumorigenesis	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29628502
Experimental Method
Sample Type	Tissues and Hep3B,Huh7 Cell lines	Comparison	H2228 or H1299 cells , non-small cell lung cancer patients versus control group
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTGCAAGTGGCTGTGAAGA Reverse TCTGTGTATTTGGAGAGGTTGTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Tan, S, Gou, Q, Pu, W, Guo, C, Yang, Y, Wu, K, Liu, Y, Liu, L, Wei, YQ, Peng, Y (2018). Circular RNA F-circEA produced from EML4-ALK fusion gene as a novel liquid biopsy biomarker for non-small cell lung cancer. Cell Res., 28, 6:693-695.